RNA quality was monitored by agarose gel electrophoresis and RNA quantity was measured by spectrophotometer. Real-time RT-PCR Gene-specific primers (Table 1) were designed to DNA Damage inhibitor produce a 150 to 200 bp amplicon for each gene. cDNAs were generated by using 5 μg of RNA and 3 μg of random hexamer primers. Using three independent cultures and RNA preparations, real-time PCR was performed in triplicate as described previously [4], through the LightCycler system (Roche) together with the SYBR Green master mix.

Based on the standard curve of 16S rRNA expression for each RNA preparation, the relative mRNA level was determined by the classic ΔCt method. 16S rRNA gene was used to normalize that of all the other genes. The transcriptional variation between the

WT and Δcrp strains was then calculated for each gene. A mean ratio of two was taken as the cutoff of statistical significance. Table 1 Oligonucleotide primers used in this study Target gene BIIB057 order Primer sequence (5′→3′) EMSA (Sense/antisense) https://www.selleckchem.com/products/KU-55933.html      sycO ATATTCTGGGACGGGTTT/TTCCTGCTGAGTTTCTGC    YPO1099 AGCCCTCTCTCCCTAGCC/GCAGTTGCCAGACCGC    YPO0180 GCTACCGAGCCTAACCC/AGGCACCCATCTCATGG Real-time PCR or RT-PCR (Sense/antisense)      sycO GCCCTTGTTTCGCTTGGAGTG/AGTTCCTGCTGAGTTTCTGCTG    ypkA GCTAAGATTGAACGCTCCATTG/TCAGAACAACGCCAACCATC    yopJ AATCCAGGCGAACAATAAATATCC/CACTGAAATGTATTCCACCTTCC    sycO-ypkA intergenic CAGGAACTGCCCCTTCATAC/ATACCGTTTTCCTCCGATATTGAG    ypkA-yopJ intergenic TGCGAGAGCTGACGACCATC/TCATTACTGATTAAAGAACTGGTC    lacA CCGATAACGATTGGCAATAACG/GCGAATAACCCGACAAGGAAC    16s rRNA TTACCTACTCTTGACATCCAC/GCTGGCAACAAAGGATAAG DNase I footprinting (Sense/antisense)      sycO CAGATTTGTCTACAGGTTCG/CTCAGCATAATAACGACTCGG LacZ reporter fusion (Sense/antisense)      sycO GCGGAATTCAGGAACGGGAAGATTTAC/GCGGGATCCAATCTCTCTGCATGAACG Primer extension      sycO

CTCAGCATAATAACGACTCGG LacZ reporter fusion and β-Galactosidase assay A 408 bp promoter-proximate of cycO (Table 1) was cloned directionally into the EcoRI Vildagliptin and BamHI sites of plasmid pRS551 expressing LacZ, which was verified by DNA sequencing. The recombinant plasmids were introduced into the WT and Δcrp, respectively. The plasmid pRS551 was also transformed as negative control. The resulting strains were grown as described in RNA isolation. β-Galactosidase activity was determined for each strain by using the Promega β-Galactosidase Enzyme Assay System [4]. Assays were performed in triplicate. DNA-binding assays Preparation of purified recombinant His-CRP protein, electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay were conducted as described previously [4]. For EMSA, a 468 bp promoter-proximate region of cycO (containing a predicted CRP binding site) or the corresponding cold probe (i.e.