To obtain an AtMinD-GFP expression vector in E. coli, the AtMinD gene was first amplified with primers: AD1F2, CGGGATCCCATGCCGCGTATCGTCGTTATC
and AD1R2, CATACCATGGTGCCGCCAAAGAAAGAGAAGA and inserted into pEGFP (Clontech, CA) between the BamHI and NcoI restriction enzyme cutting selleck kinase inhibitor sites. Then the AtMinD-GFP fusion gene was PCR-amplified with selleck chemical primers AD1F1 and GFPR, CCGAAGCTTTTACTTGTACAGCTCGTC and introduced into vector pMLB1113 between the EcoRI and HindIII restriction enzyme cutting sites. To obtain GFP-AtMinD and GFP-EcMinD expression vectors, GFP was amplified from pEGFP plasmid by primers CGAATTCAACAAGGAATTTCTATGGTGAGCAAGGGC/GCTCTAGACTTGTACAGCTCGTC and cut by EcoRI and XbaI. AtMinD or EcMinD were PCR amplified by primers AD1F3, GCTCTAGAATGCCGGAACTCGCCGGAGAAACGC/AD1R1 or EcDF2, GCTCTAGAATGGCACGCATTATTGTTGT/EcDR1 and cut by XbaI and HindIII. GFP and AtMinD or EcMinD were ligated together in vitro and then inserted into pMLB1113 between EcoRI and HindIII cutting sites. For the construction of GFP-EcMinC expression vectors, EcMinC was amplified by MCF1, Danusertib manufacturer GCTCTAGAATGTCAAACACGCCAATCG and MCR1, ATGGATCCTCAATTTAACGGTTGAACGG and cut by XbaI and BamHI. EcMinC and the GFP gene above were ligated
together in Thalidomide vitro and then inserted into pMLB1113 between EcoRI and BamHI cutting sites. To express AtMinD and GFP-EcMinC together, AtMinD was amplified by AD1F4, CGGGATCCAACAAGGAATTTCTATGCCGCGTATCGTCGTTATC and AD1R1, cut by BamHI and HindIII and then inserted into pMLB1113-GFP-EcMinC. All the constructs above were transformed into HL1 mutant (ΔMinDE) or RC1 mutant (ΔMinCDE) respectively. Yeast two-hybrid analysis AtMinD and ΔTPAtMinD were
PCR-amplified with primers YDF1, GGGTTTCATATGGCGTCTCTGAGATTGTTC and YDR, CGGGATCCTTAGC CGCCAAAGAAAG or YDF2, GGGTTTCATATGCCGGAACTCGCCGGAGA AACGC and YDR, cloned into pGADT7 and pGBK (Clontech, CA, USA) which were cut by NdeI and BamHI. EcMinC was amplified with primers CF, CGGAATTCATGTCAAACACGCCAATCG and CR, ATGGATCC TCAATTTAACGGTTGAACGG, then introduced into pGADT7 and pGBK between the restriction enzyme cutting sites EcoRI and BamHI. All the constructs were first made in E. coli DH5α and then transformed into yeast strain AH109 by using the lithium acetate method. If the two proteins fused to the bait and prey respectively can interact with each other, the cotransformed yeast cells will grow in the absence of leucine, tryptophan and histidine and in the presence of 3 mM 3-AT [29–31], according to the protocol from Clontech.